ID: 1018903438_1018903445

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1018903438 1018903445
Species Human (GRCh38) Human (GRCh38)
Location 6:168062520-168062542 6:168062542-168062564
Sequence CCCGTGAGGCCAGGACGGCCCTG GATGCCCCCGAGAGGCCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 262} {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!