ID: 1018903782_1018903800

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018903782 1018903800
Species Human (GRCh38) Human (GRCh38)
Location 6:168063814-168063836 6:168063861-168063883
Sequence CCAGCCCCCTGCTCCGAGAAGCT CAACCTCGGTGGGCAGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 308} {0: 1, 1: 0, 2: 2, 3: 23, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!