ID: 1018932906_1018932907

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1018932906 1018932907
Species Human (GRCh38) Human (GRCh38)
Location 6:168253553-168253575 6:168253566-168253588
Sequence CCGAGATGATGGTGCTTCTCCTG GCTTCTCCTGCTCTGACACTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!