ID: 1018940959_1018940969

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1018940959 1018940969
Species Human (GRCh38) Human (GRCh38)
Location 6:168308633-168308655 6:168308669-168308691
Sequence CCGTCTGTACTCCAGCCACCCTG GGGGACGCTGCATGCCTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 69, 4: 534} {0: 1, 1: 0, 2: 1, 3: 9, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!