ID: 1018962911_1018962914

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1018962911 1018962914
Species Human (GRCh38) Human (GRCh38)
Location 6:168460943-168460965 6:168460971-168460993
Sequence CCTCAGCTCTAAACACAGAGGTT CTGTGTCTGTAGAAGTGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!