ID: 1018963053_1018963055

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1018963053 1018963055
Species Human (GRCh38) Human (GRCh38)
Location 6:168462368-168462390 6:168462389-168462411
Sequence CCTGAGTCTGTATGTTGAATTAT ATCGTTTCCCGGCATCCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!