ID: 1018967709_1018967717

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1018967709 1018967717
Species Human (GRCh38) Human (GRCh38)
Location 6:168501512-168501534 6:168501542-168501564
Sequence CCCTCGCTATGGGGCCAGGAACC CATTCTGCAGAATGTGAGGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 95} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!