ID: 1018968071_1018968076

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1018968071 1018968076
Species Human (GRCh38) Human (GRCh38)
Location 6:168504124-168504146 6:168504146-168504168
Sequence CCCTGGGATGCCAGCTCACATGG GCTTCTCATCCAGCTCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 166} {0: 1, 1: 0, 2: 3, 3: 18, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!