ID: 1018973135_1018973140

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1018973135 1018973140
Species Human (GRCh38) Human (GRCh38)
Location 6:168542900-168542922 6:168542916-168542938
Sequence CCCCTGAGGAGTTTTACTGGGCA CTGGGCATGTGTATGGCTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128} {0: 1, 1: 0, 2: 1, 3: 13, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!