ID: 1018977799_1018977804

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1018977799 1018977804
Species Human (GRCh38) Human (GRCh38)
Location 6:168578728-168578750 6:168578772-168578794
Sequence CCTCATGTCATGAATTTGCTGAG TATTATGAAGAATTGGACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!