ID: 1018978197_1018978216

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1018978197 1018978216
Species Human (GRCh38) Human (GRCh38)
Location 6:168581772-168581794 6:168581804-168581826
Sequence CCCCGCTGCCTCCCTGCAGCCCC CCTTCCTCATTGACCGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 163, 4: 1146} {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!