ID: 1018983332_1018983343

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1018983332 1018983343
Species Human (GRCh38) Human (GRCh38)
Location 6:168616767-168616789 6:168616810-168616832
Sequence CCATCCCAGAGGCATCATAAGAC GTGCCGAGGAGTCAAGCGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117} {0: 1, 1: 0, 2: 1, 3: 0, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!