ID: 1019011590_1019011594

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1019011590 1019011594
Species Human (GRCh38) Human (GRCh38)
Location 6:168847552-168847574 6:168847570-168847592
Sequence CCGGGGGCCAGCTGTTTCTCTTG TCTTGTCTACTGATGGTGCCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 36, 4: 494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!