ID: 1019042364_1019042373

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1019042364 1019042373
Species Human (GRCh38) Human (GRCh38)
Location 6:169117825-169117847 6:169117869-169117891
Sequence CCCACAGGGGGTTGAGAGCTGTA CTGTCTCGAGGCCCGTGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 30, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!