ID: 1019057776_1019057779 |
View in Genome Browser |
Spacer: -2 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1019057776 | 1019057779 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:169235549-169235571 | 6:169235570-169235592 |
Sequence | CCAAGCGCTCTGTAACTCACACC | CCCTAGTCTGCACAGACGCAGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 5, 4: 91} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |