ID: 1019088489_1019088493

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1019088489 1019088493
Species Human (GRCh38) Human (GRCh38)
Location 6:169503107-169503129 6:169503126-169503148
Sequence CCCTCTGCCATGCTGTGAGCAGA CAGAGTGACGAGAAAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 434} {0: 1, 1: 1, 2: 2, 3: 24, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!