ID: 1019089948_1019089949

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1019089948 1019089949
Species Human (GRCh38) Human (GRCh38)
Location 6:169520142-169520164 6:169520158-169520180
Sequence CCAAATCGGAGTGGCTGCTCAGC GCTCAGCATCACCACACTGTAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 26, 3: 83, 4: 116} {0: 1, 1: 0, 2: 12, 3: 41, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!