ID: 1019097151_1019097156

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1019097151 1019097156
Species Human (GRCh38) Human (GRCh38)
Location 6:169591563-169591585 6:169591597-169591619
Sequence CCAAATGGGGACCAATGACATTT TTTTAGCTATAGCTTTTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131} {0: 1, 1: 1, 2: 1, 3: 25, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!