ID: 1019106471_1019106480

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1019106471 1019106480
Species Human (GRCh38) Human (GRCh38)
Location 6:169671656-169671678 6:169671690-169671712
Sequence CCCTTCTCACCCTCACCCTCAGC TCCGAGATCCTGCTTCTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 114, 4: 1238} {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!