ID: 1019106498_1019106502

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1019106498 1019106502
Species Human (GRCh38) Human (GRCh38)
Location 6:169671852-169671874 6:169671873-169671895
Sequence CCCTTCCTATTCACCACTGTGTC TCTCCAGCCTGAAATATTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 926} {0: 1, 1: 0, 2: 1, 3: 9, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!