ID: 1019120785_1019120798

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1019120785 1019120798
Species Human (GRCh38) Human (GRCh38)
Location 6:169801977-169801999 6:169801996-169802018
Sequence CCTGCGGCTGCGACCCCCTGCCT GCCTGGGGACGATGGGGTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 187} {0: 1, 1: 0, 2: 2, 3: 18, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!