ID: 1019124100_1019124109

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1019124100 1019124109
Species Human (GRCh38) Human (GRCh38)
Location 6:169827773-169827795 6:169827819-169827841
Sequence CCTCCTGTCTCTCCCTCCATCCT CCTGCTCTCTTCTTTAGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 32, 3: 329, 4: 2781} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!