ID: 1019133459_1019133468

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1019133459 1019133468
Species Human (GRCh38) Human (GRCh38)
Location 6:169893905-169893927 6:169893947-169893969
Sequence CCACCTTCTGTGGCATGGAGGCC TTCCATGGAGGAAGAGAATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!