ID: 1019147317_1019147322

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1019147317 1019147322
Species Human (GRCh38) Human (GRCh38)
Location 6:169983702-169983724 6:169983722-169983744
Sequence CCACAAGGAAAAACCACAAGGCA GCACCTGAGGAAGGGCCGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!