ID: 1019198462_1019198471

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1019198462 1019198471
Species Human (GRCh38) Human (GRCh38)
Location 6:170295982-170296004 6:170296010-170296032
Sequence CCTCCTCTGCGCCGCGGCTCCTT GGAACCCGCGGATCATCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 212} {0: 1, 1: 0, 2: 1, 3: 3, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!