ID: 1019215983_1019215986

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1019215983 1019215986
Species Human (GRCh38) Human (GRCh38)
Location 6:170444157-170444179 6:170444175-170444197
Sequence CCTGGCAGCTAGGCCTGGGCTCA GCTCAGAGCAGAAGGCTTGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 312} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!