ID: 1019219087_1019219092

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1019219087 1019219092
Species Human (GRCh38) Human (GRCh38)
Location 6:170460835-170460857 6:170460854-170460876
Sequence CCTGGAGATGAGGCGCCCTGAGG GAGGCACTAACTAAATGTTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!