ID: 1019247167_1019247174

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1019247167 1019247174
Species Human (GRCh38) Human (GRCh38)
Location 6:170716613-170716635 6:170716634-170716656
Sequence CCCCAAATCTTGCACTTTAACCC CCCATAGAGAGCTCCTGAAGGGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 0, 3: 13, 4: 149} {0: 7, 1: 0, 2: 1, 3: 8, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!