ID: 1019287899_1019287907

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1019287899 1019287907
Species Human (GRCh38) Human (GRCh38)
Location 7:232766-232788 7:232794-232816
Sequence CCTCGGCCGTGCCGGGATCGTGT GCAGGACGGGGCACCCGGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19} {0: 1, 1: 0, 2: 2, 3: 11, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!