ID: 1019288629_1019288634

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1019288629 1019288634
Species Human (GRCh38) Human (GRCh38)
Location 7:236254-236276 7:236278-236300
Sequence CCTGCTGGTCTCCGCCGAGGACG CCCTCTCCTCTCAACCTTGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!