ID: 1019290604_1019290614

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1019290604 1019290614
Species Human (GRCh38) Human (GRCh38)
Location 7:248327-248349 7:248351-248373
Sequence CCGCCGGGTCCCTCCCGTGGCCG CAGGATGGTCAACATGACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 478} {0: 1, 1: 0, 2: 0, 3: 17, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!