ID: 1019296241_1019296251

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1019296241 1019296251
Species Human (GRCh38) Human (GRCh38)
Location 7:276814-276836 7:276859-276881
Sequence CCAGGAGGGAAGGCTCCCACCAG CTGTGCCTGCCTGCTGCAGCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!