ID: 1019296254_1019296257

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1019296254 1019296257
Species Human (GRCh38) Human (GRCh38)
Location 7:276868-276890 7:276886-276908
Sequence CCTGCTGCAGCCGGTGTGATGGA ATGGAGCAGCCACTCACCTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 25, 3: 95, 4: 300} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!