ID: 1019305948_1019305962

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1019305948 1019305962
Species Human (GRCh38) Human (GRCh38)
Location 7:335833-335855 7:335876-335898
Sequence CCCCTCCTGGCCCCACTTCTGTG AGCATCCTACACCTGGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 598} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!