ID: 1019307662_1019307666

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1019307662 1019307666
Species Human (GRCh38) Human (GRCh38)
Location 7:343534-343556 7:343550-343572
Sequence CCAGCACCGTGAGACCAGAGGAC AGAGGACCCAGCAGTGAAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 41, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!