ID: 1019317137_1019317143

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1019317137 1019317143
Species Human (GRCh38) Human (GRCh38)
Location 7:391951-391973 7:391967-391989
Sequence CCCTTCCCAGGGCCTCTCTGCAC TCTGCACCCCTCAGGCCCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 28, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!