ID: 1019340743_1019340750

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1019340743 1019340750
Species Human (GRCh38) Human (GRCh38)
Location 7:507721-507743 7:507747-507769
Sequence CCAGGGAGGATGCCAAGGCCCAC AAGGCAGAAACTGCGCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 239} {0: 1, 1: 1, 2: 0, 3: 9, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!