ID: 1019340743_1019340751

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1019340743 1019340751
Species Human (GRCh38) Human (GRCh38)
Location 7:507721-507743 7:507750-507772
Sequence CCAGGGAGGATGCCAAGGCCCAC GCAGAAACTGCGCCCCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 239} {0: 1, 1: 0, 2: 2, 3: 57, 4: 587}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!