ID: 1019343004_1019343016

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1019343004 1019343016
Species Human (GRCh38) Human (GRCh38)
Location 7:517352-517374 7:517377-517399
Sequence CCCGCGCCCTCCCCGCGCGCGGA GAAGGGGCGCGATTTACCTACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 282} {0: 1, 1: 0, 2: 0, 3: 5, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!