ID: 1019348764_1019348773

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1019348764 1019348773
Species Human (GRCh38) Human (GRCh38)
Location 7:543370-543392 7:543402-543424
Sequence CCTGGCCTCAAAGTGAGTCACCC GATTCAGCCACCCTGAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 87, 4: 346} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!