ID: 1019352693_1019352703

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1019352693 1019352703
Species Human (GRCh38) Human (GRCh38)
Location 7:562365-562387 7:562398-562420
Sequence CCCTGTCGCCTCCAGCTCCACAG ACTCCTCGTCTGCCCCCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 252} {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!