ID: 1019355960_1019355974

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1019355960 1019355974
Species Human (GRCh38) Human (GRCh38)
Location 7:579111-579133 7:579156-579178
Sequence CCCATGGAGGCCCCGGACGGGCG CTCCAGAGGGAGGGTGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54} {0: 1, 1: 1, 2: 13, 3: 140, 4: 1146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!