ID: 1019355964_1019355969

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1019355964 1019355969
Species Human (GRCh38) Human (GRCh38)
Location 7:579122-579144 7:579143-579165
Sequence CCCGGACGGGCGTGCGGTCACAG AGGGCAGCACTGACTCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 58} {0: 1, 1: 0, 2: 2, 3: 26, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!