ID: 1019357976_1019357990

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1019357976 1019357990
Species Human (GRCh38) Human (GRCh38)
Location 7:590903-590925 7:590936-590958
Sequence CCGCGTGTCTGCCCCCGAGAGCG CGGATGCCCGGGGCAGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 63} {0: 1, 1: 0, 2: 1, 3: 19, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!