ID: 1019371466_1019371480

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1019371466 1019371480
Species Human (GRCh38) Human (GRCh38)
Location 7:664122-664144 7:664167-664189
Sequence CCCTTCGCCTGGCCTCTCTCCAC GGTGAATTCCTCACACCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 67, 4: 455} {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!