ID: 1019394572_1019394578

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1019394572 1019394578
Species Human (GRCh38) Human (GRCh38)
Location 7:810580-810602 7:810626-810648
Sequence CCACTCATGGCAGAGGTGAAGGG CAGGAGCAAGAGAGGCCGTGAGG
Strand - +
Off-target summary {0: 5, 1: 8, 2: 22, 3: 58, 4: 401} {0: 1, 1: 1, 2: 9, 3: 145, 4: 776}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!