ID: 1019395927_1019395936

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1019395927 1019395936
Species Human (GRCh38) Human (GRCh38)
Location 7:817443-817465 7:817478-817500
Sequence CCACTGTCACCGTCATGGGGAGG TCCCCAGGGCTCCCCAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 94} {0: 1, 1: 0, 2: 3, 3: 58, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!