ID: 1019399515_1019399522

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1019399515 1019399522
Species Human (GRCh38) Human (GRCh38)
Location 7:844237-844259 7:844263-844285
Sequence CCAGGATCTCTCTCACCTGCAGC AAGAGGCTGGGACCCTCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 364} {0: 1, 1: 0, 2: 4, 3: 31, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!