ID: 1019414754_1019414764

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1019414754 1019414764
Species Human (GRCh38) Human (GRCh38)
Location 7:922134-922156 7:922158-922180
Sequence CCCTGGAGGGGCCGCACTGACAC CCACGTGGTCACGAGGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!