|
Left Crispr |
Right Crispr |
| Crispr ID |
1019431509 |
1019431515 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:1001796-1001818
|
7:1001813-1001835
|
| Sequence |
CCTGTGGGTAGGGAGTCCTGTGG |
CTGTGGGTGTGGAGCCCTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 36, 2: 21, 3: 23, 4: 185} |
{0: 3, 1: 0, 2: 40, 3: 48, 4: 340} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|